MirOS Manual: perlretut(1)


PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

NAME

     perlretut - Perl regular expressions tutorial

DESCRIPTION

     This page provides a basic tutorial on understanding, creat-
     ing and using regular expressions in Perl.  It serves as a
     complement to the reference page on regular expressions
     perlre.  Regular expressions are an integral part of the
     "m//", "s///", "qr//" and "split" operators and so this
     tutorial also overlaps with "Regexp Quote-Like Operators" in
     perlop and "split" in perlfunc.

     Perl is widely renowned for excellence in text processing,
     and regular expressions are one of the big factors behind
     this fame.  Perl regular expressions display an efficiency
     and flexibility unknown in most other computer languages.
     Mastering even the basics of regular expressions will allow
     you to manipulate text with surprising ease.

     What is a regular expression?  A regular expression is sim-
     ply a string that describes a pattern.  Patterns are in com-
     mon use these days; examples are the patterns typed into a
     search engine to find web pages and the patterns used to
     list files in a directory, e.g., "ls *.txt" or "dir *.*".
     In Perl, the patterns described by regular expressions are
     used to search strings, extract desired parts of strings,
     and to do search and replace operations.

     Regular expressions have the undeserved reputation of being
     abstract and difficult to understand.  Regular expressions
     are constructed using simple concepts like conditionals and
     loops and are no more difficult to understand than the
     corresponding "if" conditionals and "while" loops in the
     Perl language itself.  In fact, the main challenge in learn-
     ing regular expressions is just getting used to the terse
     notation used to express these concepts.

     This tutorial flattens the learning curve by discussing reg-
     ular expression concepts, along with their notation, one at
     a time and with many examples.  The first part of the
     tutorial will progress from the simplest word searches to
     the basic regular expression concepts.  If you master the
     first part, you will have all the tools needed to solve
     about 98% of your needs.  The second part of the tutorial is
     for those comfortable with the basics and hungry for more
     power tools.  It discusses the more advanced regular expres-
     sion operators and introduces the latest cutting edge inno-
     vations in 5.6.0.

     A note: to save time, 'regular expression' is often abbrevi-
     ated as regexp or regex.  Regexp is a more natural abbrevia-
     tion than regex, but is harder to pronounce.  The Perl pod

perl v5.8.8                2006-06-30                           1

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     documentation is evenly split on regexp vs regex; in Perl,
     there is more than one way to abbreviate it. We'll use
     regexp in this tutorial.

Part 1: The basics
     Simple word matching

     The simplest regexp is simply a word, or more generally, a
     string of characters.  A regexp consisting of a word matches
     any string that contains that word:

         "Hello World" =~ /World/;  # matches

     What is this perl statement all about? "Hello World" is a
     simple double quoted string.  "World" is the regular expres-
     sion and the "//" enclosing "/World/" tells perl to search a
     string for a match. The operator "=~" associates the string
     with the regexp match and produces a true value if the
     regexp matched, or false if the regexp did not match.  In
     our case, "World" matches the second word in "Hello World",
     so the expression is true.  Expressions like this are useful
     in conditionals:

         if ("Hello World" =~ /World/) {
             print "It matches\n";
         }
         else {
             print "It doesn't match\n";
         }

     There are useful variations on this theme.  The sense of the
     match can be reversed by using "!~" operator:

         if ("Hello World" !~ /World/) {
             print "It doesn't match\n";
         }
         else {
             print "It matches\n";
         }

     The literal string in the regexp can be replaced by a vari-
     able:

         $greeting = "World";
         if ("Hello World" =~ /$greeting/) {
             print "It matches\n";
         }
         else {
             print "It doesn't match\n";
         }

perl v5.8.8                2006-06-30                           2

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     If you're matching against the special default variable $_,
     the "$_ =~" part can be omitted:

         $_ = "Hello World";
         if (/World/) {
             print "It matches\n";
         }
         else {
             print "It doesn't match\n";
         }

     And finally, the "//" default delimiters for a match can be
     changed to arbitrary delimiters by putting an 'm' out front:

         "Hello World" =~ m!World!;   # matches, delimited by '!'
         "Hello World" =~ m{World};   # matches, note the matching '{}'
         "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                      # '/' becomes an ordinary char

     "/World/", "m!World!", and "m{World}" all represent the same
     thing.  When, e.g., "" is used as a delimiter, the forward
     slash '/' becomes an ordinary character and can be used in a
     regexp without trouble.

     Let's consider how different regexps would match "Hello
     World":

         "Hello World" =~ /world/;  # doesn't match
         "Hello World" =~ /o W/;    # matches
         "Hello World" =~ /oW/;     # doesn't match
         "Hello World" =~ /World /; # doesn't match

     The first regexp "world" doesn't match because regexps are
     case-sensitive.  The second regexp matches because the sub-
     string 'o W'  occurs in the string "Hello World" .  The
     space character ' ' is treated like any other character in a
     regexp and is needed to match in this case.  The lack of a
     space character is the reason the third regexp 'oW' doesn't
     match.  The fourth regexp 'World ' doesn't match because
     there is a space at the end of the regexp, but not at the
     end of the string.  The lesson here is that regexps must
     match a part of the string exactly in order for the state-
     ment to be true.

     If a regexp matches in more than one place in the string,
     perl will always match at the earliest possible point in the
     string:

         "Hello World" =~ /o/;       # matches 'o' in 'Hello'
         "That hat is red" =~ /hat/; # matches 'hat' in 'That'

perl v5.8.8                2006-06-30                           3

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     With respect to character matching, there are a few more
     points you need to know about.   First of all, not all char-
     acters can be used 'as is' in a match.  Some characters,
     called metacharacters, are reserved for use in regexp nota-
     tion.  The metacharacters are

         {}[]()^$.|*+?\

     The significance of each of these will be explained in the
     rest of the tutorial, but for now, it is important only to
     know that a metacharacter can be matched by putting a
     backslash before it:

         "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
         "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
         "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
         "The interval is [0,1)." =~ /\[0,1\)\./  # matches
         "/usr/bin/perl" =~ /\/usr\/bin\/perl/;  # matches

     In the last regexp, the forward slash '/' is also
     backslashed, because it is used to delimit the regexp.  This
     can lead to LTS (leaning toothpick syndrome), however, and
     it is often more readable to change delimiters.

         "/usr/bin/perl" =~ m!/usr/bin/perl!;    # easier to read

     The backslash character '\' is a metacharacter itself and
     needs to be backslashed:

         'C:\WIN32' =~ /C:\\WIN/;   # matches

     In addition to the metacharacters, there are some ASCII
     characters which don't have printable character equivalents
     and are instead represented by escape sequences.  Common
     examples are "\t" for a tab, "\n" for a newline, "\r" for a
     carriage return and "\a" for a bell.  If your string is
     better thought of as a sequence of arbitrary bytes, the
     octal escape sequence, e.g., "\033", or hexadecimal escape
     sequence, e.g., "\x1B" may be a more natural representation
     for your bytes.  Here are some examples of escapes:

         "1000\t2000" =~ m(0\t2)   # matches
         "1000\n2000" =~ /0\n20/   # matches
         "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
         "cat"        =~ /\143\x61\x74/ # matches, but a weird way to spell cat

     If you've been around Perl a while, all this talk of escape
     sequences may seem familiar.  Similar escape sequences are
     used in double-quoted strings and in fact the regexps in
     Perl are mostly treated as double-quoted strings.  This
     means that variables can be used in regexps as well.  Just
     like double-quoted strings, the values of the variables in

perl v5.8.8                2006-06-30                           4

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     the regexp will be substituted in before the regexp is
     evaluated for matching purposes.  So we have:

         $foo = 'house';
         'housecat' =~ /$foo/;      # matches
         'cathouse' =~ /cat$foo/;   # matches
         'housecat' =~ /${foo}cat/; # matches

     So far, so good.  With the knowledge above you can already
     perform searches with just about any literal string regexp
     you can dream up. Here is a very simple emulation of the
     Unix grep program:

         % cat > simple_grep
         #!/usr/bin/perl
         $regexp = shift;
         while (<>) {
             print if /$regexp/;
         }
         ^D

         % chmod +x simple_grep

         % simple_grep abba /usr/dict/words
         Babbage
         cabbage
         cabbages
         sabbath
         Sabbathize
         Sabbathizes
         sabbatical
         scabbard
         scabbards

     This program is easy to understand.  "#!/usr/bin/perl" is
     the standard way to invoke a perl program from the shell.
     "$regexp = shift;"  saves the first command line argument as
     the regexp to be used, leaving the rest of the command line
     arguments to be treated as files.  "while (<>)"  loops over
     all the lines in all the files.  For each line,
     "print if /$regexp/;"  prints the line if the regexp matches
     the line.  In this line, both "print" and "/$regexp/" use
     the default variable $_ implicitly.

     With all of the regexps above, if the regexp matched any-
     where in the string, it was considered a match.  Sometimes,
     however, we'd like to specify where in the string the regexp
     should try to match.  To do this, we would use the anchor
     metacharacters "^" and "$".  The anchor "^" means match at
     the beginning of the string and the anchor "$" means match
     at the end of the string, or before a newline at the end of
     the string.  Here is how they are used:

perl v5.8.8                2006-06-30                           5

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         "housekeeper" =~ /keeper/;    # matches
         "housekeeper" =~ /^keeper/;   # doesn't match
         "housekeeper" =~ /keeper$/;   # matches
         "housekeeper\n" =~ /keeper$/; # matches

     The second regexp doesn't match because "^" constrains
     "keeper" to match only at the beginning of the string, but
     "housekeeper" has keeper starting in the middle.  The third
     regexp does match, since the "$" constrains "keeper" to
     match only at the end of the string.

     When both "^" and "$" are used at the same time, the regexp
     has to match both the beginning and the end of the string,
     i.e., the regexp matches the whole string.  Consider

         "keeper" =~ /^keep$/;      # doesn't match
         "keeper" =~ /^keeper$/;    # matches
         ""       =~ /^$/;          # ^$ matches an empty string

     The first regexp doesn't match because the string has more
     to it than "keep".  Since the second regexp is exactly the
     string, it matches.  Using both "^" and "$" in a regexp
     forces the complete string to match, so it gives you com-
     plete control over which strings match and which don't.
     Suppose you are looking for a fellow named bert, off in a
     string by himself:

         "dogbert" =~ /bert/;   # matches, but not what you want

         "dilbert" =~ /^bert/;  # doesn't match, but ..
         "bertram" =~ /^bert/;  # matches, so still not good enough

         "bertram" =~ /^bert$/; # doesn't match, good
         "dilbert" =~ /^bert$/; # doesn't match, good
         "bert"    =~ /^bert$/; # matches, perfect

     Of course, in the case of a literal string, one could just
     as easily use the string equivalence "$string eq 'bert'"
     and it would be more efficient.   The  "^...$" regexp really
     becomes useful when we add in the more powerful regexp tools
     below.

     Using character classes

     Although one can already do quite a lot with the literal
     string regexps above, we've only scratched the surface of
     regular expression technology.  In this and subsequent sec-
     tions we will introduce regexp concepts (and associated
     metacharacter notations) that will allow a regexp to not
     just represent a single character sequence, but a whole
     class of them.

perl v5.8.8                2006-06-30                           6

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     One such concept is that of a character class.  A character
     class allows a set of possible characters, rather than just
     a single character, to match at a particular point in a
     regexp.  Character classes are denoted by brackets "[...]",
     with the set of characters to be possibly matched inside.
     Here are some examples:

         /cat/;       # matches 'cat'
         /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
         /item[0123456789]/;  # matches 'item0' or ... or 'item9'
         "abc" =~ /[cab]/;    # matches 'a'

     In the last statement, even though 'c' is the first charac-
     ter in the class, 'a' matches because the first character
     position in the string is the earliest point at which the
     regexp can match.

         /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                              # 'yes', 'Yes', 'YES', etc.

     This regexp displays a common task: perform a case-
     insensitive match.  Perl provides away of avoiding all those
     brackets by simply appending an 'i' to the end of the match.
     Then "/[yY][eE][sS]/;" can be rewritten as "/yes/i;".  The
     'i' stands for case-insensitive and is an example of a
     modifier of the matching operation.  We will meet other
     modifiers later in the tutorial.

     We saw in the section above that there were ordinary charac-
     ters, which represented themselves, and special characters,
     which needed a backslash "\" to represent themselves.  The
     same is true in a character class, but the sets of ordinary
     and special characters inside a character class are dif-
     ferent than those outside a character class.  The special
     characters for a character class are "-]\^$".  "]" is spe-
     cial because it denotes the end of a character class.  "$"
     is special because it denotes a scalar variable.  "\" is
     special because it is used in escape sequences, just like
     above.  Here is how the special characters "]$\" are han-
     dled:

        /[\]c]def/; # matches ']def' or 'cdef'
        $x = 'bcr';
        /[$x]at/;   # matches 'bat', 'cat', or 'rat'
        /[\$x]at/;  # matches '$at' or 'xat'
        /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

     The last two are a little tricky.  in "[\$x]", the backslash
     protects the dollar sign, so the character class has two
     members "$" and "x". In "[\\$x]", the backslash is pro-
     tected, so $x is treated as a variable and substituted in
     double quote fashion.

perl v5.8.8                2006-06-30                           7

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     The special character '-' acts as a range operator within
     character classes, so that a contiguous set of characters
     can be written as a range.  With ranges, the unwieldy
     "[0123456789]" and "[abc...xyz]" become the svelte "[0-9]"
     and "[a-z]".  Some examples are

         /item[0-9]/;  # matches 'item0' or ... or 'item9'
         /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                         # 'baa', 'xaa', 'yaa', or 'zaa'
         /[0-9a-fA-F]/;  # matches a hexadecimal digit
         /[0-9a-zA-Z_]/; # matches a "word" character,
                         # like those in a perl variable name

     If '-' is the first or last character in a character class,
     it is treated as an ordinary character; "[-ab]", "[ab-]" and
     "[a\-b]" are all equivalent.

     The special character "^" in the first position of a charac-
     ter class denotes a negated character class, which matches
     any character but those in the brackets.  Both "[...]" and
     "[^...]" must match a character, or the match fails.  Then

         /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                    # all other 'bat', 'cat, '0at', '%at', etc.
         /[^0-9]/;  # matches a non-numeric character
         /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

     Now, even "[0-9]" can be a bother the write multiple times,
     so in the interest of saving keystrokes and making regexps
     more readable, Perl has several abbreviations for common
     character classes:

     +   \d is a digit and represents [0-9]

     +   \s is a whitespace character and represents [\ \t\r\n\f]

     +   \w is a word character (alphanumeric or _) and
         represents [0-9a-zA-Z_]

     +   \D is a negated \d; it represents any character but a
         digit [^0-9]

     +   \S is a negated \s; it represents any non-whitespace
         character [^\s]

     +   \W is a negated \w; it represents any non-word character
         [^\w]

     +   The period '.' matches any character but "\n"

     The "\d\s\w\D\S\W" abbreviations can be used both inside and
     outside of character classes.  Here are some in use:

perl v5.8.8                2006-06-30                           8

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
         /[\d\s]/;         # matches any digit or whitespace character
         /\w\W\w/;         # matches a word char, followed by a
                           # non-word char, followed by a word char
         /..rt/;           # matches any two chars, followed by 'rt'
         /end\./;          # matches 'end.'
         /end[.]/;         # same thing, matches 'end.'

     Because a period is a metacharacter, it needs to be escaped
     to match as an ordinary period. Because, for example, "\d"
     and "\w" are sets of characters, it is incorrect to think of
     "[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is the same as
     "[^\w]", which is the same as "[\W]". Think DeMorgan's laws.

     An anchor useful in basic regexps is the word anchor  "\b".
     This matches a boundary between a word character and a non-
     word character "\w\W" or "\W\w":

         $x = "Housecat catenates house and cat";
         $x =~ /cat/;    # matches cat in 'housecat'
         $x =~ /\bcat/;  # matches cat in 'catenates'
         $x =~ /cat\b/;  # matches cat in 'housecat'
         $x =~ /\bcat\b/;  # matches 'cat' at end of string

     Note in the last example, the end of the string is con-
     sidered a word boundary.

     You might wonder why '.' matches everything but "\n" - why
     not every character? The reason is that often one is match-
     ing against lines and would like to ignore the newline char-
     acters.  For instance, while the string "\n" represents one
     line, we would like to think of as empty.  Then

         ""   =~ /^$/;    # matches
         "\n" =~ /^$/;    # matches, "\n" is ignored

         ""   =~ /./;      # doesn't match; it needs a char
         ""   =~ /^.$/;    # doesn't match; it needs a char
         "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
         "a"  =~ /^.$/;    # matches
         "a\n"  =~ /^.$/;  # matches, ignores the "\n"

     This behavior is convenient, because we usually want to
     ignore newlines when we count and match characters in a
     line.  Sometimes, however, we want to keep track of new-
     lines.  We might even want "^" and "$" to anchor at the
     beginning and end of lines within the string, rather than
     just the beginning and end of the string.  Perl allows us to
     choose between ignoring and paying attention to newlines by
     using the "//s" and "//m" modifiers.  "//s" and "//m" stand
     for single line and multi-line and they determine whether a
     string is to be treated as one continuous string, or as a

perl v5.8.8                2006-06-30                           9

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     set of lines.  The two modifiers affect two aspects of how
     the regexp is interpreted: 1) how the '.' character class is
     defined, and 2) where the anchors "^" and "$" are able to
     match.  Here are the four possible combinations:

     +   no modifiers (//): Default behavior.  '.' matches any
         character except "\n".  "^" matches only at the begin-
         ning of the string and "$" matches only at the end or
         before a newline at the end.

     +   s modifier (//s): Treat string as a single long line.
         '.' matches any character, even "\n".  "^" matches only
         at the beginning of the string and "$" matches only at
         the end or before a newline at the end.

     +   m modifier (//m): Treat string as a set of multiple
         lines.  '.' matches any character except "\n".  "^" and
         "$" are able to match at the start or end of any line
         within the string.

     +   both s and m modifiers (//sm): Treat string as a single
         long line, but detect multiple lines.  '.' matches any
         character, even "\n".  "^" and "$", however, are able to
         match at the start or end of any line within the string.

     Here are examples of "//s" and "//m" in action:

         $x = "There once was a girl\nWho programmed in Perl\n";

         $x =~ /^Who/;   # doesn't match, "Who" not at start of string
         $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
         $x =~ /^Who/m;  # matches, "Who" at start of second line
         $x =~ /^Who/sm; # matches, "Who" at start of second line

         $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
         $x =~ /girl.Who/s;  # matches, "." matches "\n"
         $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
         $x =~ /girl.Who/sm; # matches, "." matches "\n"

     Most of the time, the default behavior is what is want, but
     "//s" and "//m" are occasionally very useful.  If "//m" is
     being used, the start of the string can still be matched
     with "\A" and the end of string can still be matched with
     the anchors "\Z" (matches both the end and the newline
     before, like "$"), and "\z" (matches only the end):

         $x =~ /^Who/m;   # matches, "Who" at start of second line
         $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

         $x =~ /girl$/m;  # matches, "girl" at end of first line
         $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

perl v5.8.8                2006-06-30                          10

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
         $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

     We now know how to create choices among classes of charac-
     ters in a regexp.  What about choices among words or charac-
     ter strings? Such choices are described in the next section.

     Matching this or that

     Sometimes we would like to our regexp to be able to match
     different possible words or character strings.  This is
     accomplished by using the alternation metacharacter "|".  To
     match "dog" or "cat", we form the regexp "dog|cat".  As
     before, perl will try to match the regexp at the earliest
     possible point in the string.  At each character position,
     perl will first try to match the first alternative, "dog".
     If "dog" doesn't match, perl will then try the next alterna-
     tive, "cat".  If "cat" doesn't match either, then the match
     fails and perl moves to the next position in the string.
     Some examples:

         "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
         "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

     Even though "dog" is the first alternative in the second
     regexp, "cat" is able to match earlier in the string.

         "cats"          =~ /c|ca|cat|cats/; # matches "c"
         "cats"          =~ /cats|cat|ca|c/; # matches "cats"

     Here, all the alternatives match at the first string posi-
     tion, so the first alternative is the one that matches.  If
     some of the alternatives are truncations of the others, put
     the longest ones first to give them a chance to match.

         "cab" =~ /a|b|c/ # matches "c"
                          # /a|b|c/ == /[abc]/

     The last example points out that character classes are like
     alternations of characters.  At a given character position,
     the first alternative that allows the regexp match to
     succeed will be the one that matches.

     Grouping things and hierarchical matching

     Alternation allows a regexp to choose among alternatives,
     but by itself it unsatisfying.  The reason is that each
     alternative is a whole regexp, but sometime we want alterna-
     tives for just part of a regexp.  For instance, suppose we
     want to search for housecats or housekeepers.  The regexp
     "housecat|housekeeper" fits the bill, but is inefficient
     because we had to type "house" twice.  It would be nice to

perl v5.8.8                2006-06-30                          11

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     have parts of the regexp be constant, like "house", and some
     parts have alternatives, like "cat|keeper".

     The grouping metacharacters "()" solve this problem.  Group-
     ing allows parts of a regexp to be treated as a single unit.
     Parts of a regexp are grouped by enclosing them in
     parentheses.  Thus we could solve the "housecat|housekeeper"
     by forming the regexp as "house(cat|keeper)".  The regexp
     "house(cat|keeper)" means match "house" followed by either
     "cat" or "keeper".  Some more examples are

         /(a|b)b/;    # matches 'ab' or 'bb'
         /(ac|b)b/;   # matches 'acb' or 'bb'
         /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
         /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

         /house(cat|)/;  # matches either 'housecat' or 'house'
         /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                             # 'house'.  Note groups can be nested.

         /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
         "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                  # because '20\d\d' can't match

     Alternations behave the same way in groups as out of them:
     at a given string position, the leftmost alternative that
     allows the regexp to match is taken.  So in the last example
     at the first string position, "20" matches the second alter-
     native, but there is nothing left over to match the next two
     digits "\d\d".  So perl moves on to the next alternative,
     which is the null alternative and that works, since "20" is
     two digits.

     The process of trying one alternative, seeing if it matches,
     and moving on to the next alternative if it doesn't, is
     called backtracking.  The term 'backtracking' comes from the
     idea that matching a regexp is like a walk in the woods.
     Successfully matching a regexp is like arriving at a desti-
     nation.  There are many possible trailheads, one for each
     string position, and each one is tried in order, left to
     right.  From each trailhead there may be many paths, some of
     which get you there, and some which are dead ends.  When you
     walk along a trail and hit a dead end, you have to backtrack
     along the trail to an earlier point to try another trail.
     If you hit your destination, you stop immediately and forget
     about trying all the other trails.  You are persistent, and
     only if you have tried all the trails from all the trail-
     heads and not arrived at your destination, do you declare
     failure.  To be concrete, here is a step-by-step analysis of
     what perl does when it tries to match the regexp

perl v5.8.8                2006-06-30                          12

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         "abcde" =~ /(abd|abc)(df|d|de)/;

     0   Start with the first letter in the string 'a'.

     1   Try the first alternative in the first group 'abd'.

     2   Match 'a' followed by 'b'. So far so good.

     3   'd' in the regexp doesn't match 'c' in the string - a
         dead end.  So backtrack two characters and pick the
         second alternative in the first group 'abc'.

     4   Match 'a' followed by 'b' followed by 'c'.  We are on a
         roll and have satisfied the first group. Set $1 to
         'abc'.

     5   Move on to the second group and pick the first alterna-
         tive 'df'.

     6   Match the 'd'.

     7   'f' in the regexp doesn't match 'e' in the string, so a
         dead end.  Backtrack one character and pick the second
         alternative in the second group 'd'.

     8   'd' matches. The second grouping is satisfied, so set $2
         to 'd'.

     9   We are at the end of the regexp, so we are done! We have
         matched 'abcd' out of the string "abcde".

     There are a couple of things to note about this analysis.
     First, the third alternative in the second group 'de' also
     allows a match, but we stopped before we got to it - at a
     given character position, leftmost wins.  Second, we were
     able to get a match at the first character position of the
     string 'a'.  If there were no matches at the first position,
     perl would move to the second character position 'b' and
     attempt the match all over again.  Only when all possible
     paths at all possible character positions have been
     exhausted does perl give up and declare
     "$string =~ /(abd|abc)(df|d|de)/;"  to be false.

     Even with all this work, regexp matching happens remarkably
     fast.  To speed things up, during compilation stage, perl
     compiles the regexp into a compact sequence of opcodes that
     can often fit inside a processor cache.  When the code is
     executed, these opcodes can then run at full throttle and
     search very quickly.

perl v5.8.8                2006-06-30                          13

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     Extracting matches

     The grouping metacharacters "()" also serve another com-
     pletely different function: they allow the extraction of the
     parts of a string that matched.  This is very useful to find
     out what matched and for text processing in general.  For
     each grouping, the part that matched inside goes into the
     special variables $1, $2, etc.  They can be used just as
     ordinary variables:

         # extract hours, minutes, seconds
         if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
             $hours = $1;
             $minutes = $2;
             $seconds = $3;
         }

     Now, we know that in scalar context,
     "$time =~ /(\d\d):(\d\d):(\d\d)/"  returns a true or false
     value.  In list context, however, it returns the list of
     matched values "($1,$2,$3)".  So we could write the code
     more compactly as

         # extract hours, minutes, seconds
         ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

     If the groupings in a regexp are nested, $1 gets the group
     with the leftmost opening parenthesis, $2 the next opening
     parenthesis, etc.  For example, here is a complex regexp and
     the matching variables indicated below it:

         /(ab(cd|ef)((gi)|j))/;
          1  2      34

     so that if the regexp matched, e.g., $2 would contain 'cd'
     or 'ef'. For convenience, perl sets $+ to the string held by
     the highest numbered $1, $2, ... that got assigned (and,
     somewhat related, $^N to the value of the $1, $2, ... most-
     recently assigned; i.e. the $1, $2, ... associated with the
     rightmost closing parenthesis used in the match).

     Closely associated with the matching variables $1, $2, ...
     are the backreferences "\1", "\2", ... .  Backreferences are
     simply matching variables that can be used inside a regexp.
     This is a really nice feature - what matches later in a
     regexp can depend on what matched earlier in the regexp.
     Suppose we wanted to look for doubled words in text, like
     'the the'.  The following regexp finds all 3-letter doubles
     with a space in between:

         /(\w\w\w)\s\1/;

perl v5.8.8                2006-06-30                          14

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     The grouping assigns a value to \1, so that the same 3
     letter sequence is used for both parts.  Here are some words
     with repeated parts:

         % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
         beriberi
         booboo
         coco
         mama
         murmur
         papa

     The regexp has a single grouping which considers 4-letter
     combinations, then 3-letter combinations, etc.  and uses
     "\1" to look for a repeat.  Although $1 and "\1" represent
     the same thing, care should be taken to use matched vari-
     ables $1, $2, ... only outside a regexp and backreferences
     "\1", "\2", ... only inside a regexp; not doing so may lead
     to surprising and/or undefined results.

     In addition to what was matched, Perl 5.6.0 also provides
     the positions of what was matched with the "@-" and "@+"
     arrays. "$-[0]" is the position of the start of the entire
     match and $+[0] is the position of the end. Similarly,
     "$-[n]" is the position of the start of the $n match and
     $+[n] is the position of the end. If $n is undefined, so are
     "$-[n]" and $+[n]. Then this code

         $x = "Mmm...donut, thought Homer";
         $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
         foreach $expr (1..$#-) {
             print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
         }

     prints

         Match 1: 'Mmm' at position (0,3)
         Match 2: 'donut' at position (6,11)

     Even if there are no groupings in a regexp, it is still pos-
     sible to find out what exactly matched in a string.  If you
     use them, perl will set $` to the part of the string before
     the match, will set $& to the part of the string that
     matched, and will set $' to the part of the string after the
     match.  An example:

         $x = "the cat caught the mouse";
         $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
         $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

     In the second match, "$` = ''"  because the regexp matched
     at the first character position in the string and stopped,

perl v5.8.8                2006-06-30                          15

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     it never saw the second 'the'.  It is important to note that
     using $` and $' slows down regexp matching quite a bit, and
     $&  slows it down to a lesser extent, because if they are
     used in one regexp in a program, they are generated for
     <all> regexps in the program.  So if raw performance is a
     goal of your application, they should be avoided. If you
     need them, use "@-" and "@+" instead:

         $` is the same as substr( $x, 0, $-[0] )
         $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
         $' is the same as substr( $x, $+[0] )

     Matching repetitions

     The examples in the previous section display an annoying
     weakness.  We were only matching 3-letter words, or syll-
     ables of 4 letters or less.  We'd like to be able to match
     words or syllables of any length, without writing out tedi-
     ous alternatives like "\w\w\w\w|\w\w\w|\w\w|\w".

     This is exactly the problem the quantifier metacharacters
     "?", "*", "+", and "{}" were created for.  They allow us to
     determine the number of repeats of a portion of a regexp we
     consider to be a match.  Quantifiers are put immediately
     after the character, character class, or grouping that we
     want to specify.  They have the following meanings:

     +   "a?" = match 'a' 1 or 0 times

     +   "a*" = match 'a' 0 or more times, i.e., any number of
         times

     +   "a+" = match 'a' 1 or more times, i.e., at least once

     +   "a{n,m}" = match at least "n" times, but not more than
         "m" times.

     +   "a{n,}" = match at least "n" or more times

     +   "a{n}" = match exactly "n" times

     Here are some examples:

         /[a-z]+\s+\d*/;  # match a lowercase word, at least some space, and
                          # any number of digits
         /(\w+)\s+\1/;    # match doubled words of arbitrary length
         /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
         $year =~ /\d{2,4}/;  # make sure year is at least 2 but not more
                              # than 4 digits
         $year =~ /\d{4}|\d{2}/;    # better match; throw out 3 digit dates
         $year =~ /\d{2}(\d{2})?/;  # same thing written differently. However,
                                    # this produces $1 and the other does not.

perl v5.8.8                2006-06-30                          16

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         % simple_grep '^(\w+)\1$' /usr/dict/words   # isn't this easier?
         beriberi
         booboo
         coco
         mama
         murmur
         papa

     For all of these quantifiers, perl will try to match as much
     of the string as possible, while still allowing the regexp
     to succeed.  Thus with "/a?.../", perl will first try to
     match the regexp with the "a" present; if that fails, perl
     will try to match the regexp without the "a" present.  For
     the quantifier "*", we get the following:

         $x = "the cat in the hat";
         $x =~ /^(.*)(cat)(.*)$/; # matches,
                                  # $1 = 'the '
                                  # $2 = 'cat'
                                  # $3 = ' in the hat'

     Which is what we might expect, the match finds the only
     "cat" in the string and locks onto it.  Consider, however,
     this regexp:

         $x =~ /^(.*)(at)(.*)$/; # matches,
                                 # $1 = 'the cat in the h'
                                 # $2 = 'at'
                                 # $3 = ''   (0 matches)

     One might initially guess that perl would find the "at" in
     "cat" and stop there, but that wouldn't give the longest
     possible string to the first quantifier ".*".  Instead, the
     first quantifier ".*" grabs as much of the string as possi-
     ble while still having the regexp match.  In this example,
     that means having the "at" sequence with the final "at" in
     the string.  The other important principle illustrated here
     is that when there are two or more elements in a regexp, the
     leftmost quantifier, if there is one, gets to grab as much
     the string as possible, leaving the rest of the regexp to
     fight over scraps.  Thus in our example, the first quantif-
     ier ".*" grabs most of the string, while the second quantif-
     ier ".*" gets the empty string.   Quantifiers that grab as
     much of the string as possible are called maximal match or
     greedy quantifiers.

     When a regexp can match a string in several different ways,
     we can use the principles above to predict which way the
     regexp will match:

     +   Principle 0: Taken as a whole, any regexp will be
         matched at the earliest possible position in the string.

perl v5.8.8                2006-06-30                          17

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     +   Principle 1: In an alternation "a|b|c...", the leftmost
         alternative that allows a match for the whole regexp
         will be the one used.

     +   Principle 2: The maximal matching quantifiers "?", "*",
         "+" and "{n,m}" will in general match as much of the
         string as possible while still allowing the whole regexp
         to match.

     +   Principle 3: If there are two or more elements in a
         regexp, the leftmost greedy quantifier, if any, will
         match as much of the string as possible while still
         allowing the whole regexp to match.  The next leftmost
         greedy quantifier, if any, will try to match as much of
         the string remaining available to it as possible, while
         still allowing the whole regexp to match.  And so on,
         until all the regexp elements are satisfied.

     As we have seen above, Principle 0 overrides the others -
     the regexp will be matched as early as possible, with the
     other principles determining how the regexp matches at that
     earliest character position.

     Here is an example of these principles in action:

         $x = "The programming republic of Perl";
         $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                   # $1 = 'The programming republic of Pe'
                                   # $2 = 'r'
                                   # $3 = 'l'

     This regexp matches at the earliest string position, 'T'.
     One might think that "e", being leftmost in the alternation,
     would be matched, but "r" produces the longest string in the
     first quantifier.

         $x =~ /(m{1,2})(.*)$/;  # matches,
                                 # $1 = 'mm'
                                 # $2 = 'ing republic of Perl'

     Here, The earliest possible match is at the first 'm' in
     "programming". "m{1,2}" is the first quantifier, so it gets
     to match a maximal "mm".

         $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'm'
                                   # $2 = 'ing republic of Perl'

     Here, the regexp matches at the start of the string. The
     first quantifier ".*" grabs as much as possible, leaving
     just a single 'm' for the second quantifier "m{1,2}".

perl v5.8.8                2006-06-30                          18

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'a'
                                     # $2 = 'mm'
                                     # $3 = 'ing republic of Perl'

     Here, ".?" eats its maximal one character at the earliest
     possible position in the string, 'a' in "programming", leav-
     ing "m{1,2}" the opportunity to match both "m"'s. Finally,

         "aXXXb" =~ /(X*)/; # matches with $1 = ''

     because it can match zero copies of 'X' at the beginning of
     the string.  If you definitely want to match at least one
     'X', use "X+", not "X*".

     Sometimes greed is not good.  At times, we would like quan-
     tifiers to match a minimal piece of string, rather than a
     maximal piece.  For this purpose, Larry Wall created the
     minimal match  or non-greedy quantifiers "??","*?", "+?",
     and "{}?".  These are the usual quantifiers with a "?"
     appended to them.  They have the following meanings:

     +   "a??" = match 'a' 0 or 1 times. Try 0 first, then 1.

     +   "a*?" = match 'a' 0 or more times, i.e., any number of
         times, but as few times as possible

     +   "a+?" = match 'a' 1 or more times, i.e., at least once,
         but as few times as possible

     +   "a{n,m}?" = match at least "n" times, not more than "m"
         times, as few times as possible

     +   "a{n,}?" = match at least "n" times, but as few times as
         possible

     +   "a{n}?" = match exactly "n" times.  Because we match
         exactly "n" times, "a{n}?" is equivalent to "a{n}" and
         is just there for notational consistency.

     Let's look at the example above, but with minimal quantif-
     iers:

         $x = "The programming republic of Perl";
         $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                   # $1 = 'Th'
                                   # $2 = 'e'
                                   # $3 = ' programming republic of Perl'

     The minimal string that will allow both the start of the
     string "^" and the alternation to match is "Th", with the
     alternation "e|r" matching "e".  The second quantifier ".*"

perl v5.8.8                2006-06-30                          19

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     is free to gobble up the rest of the string.

         $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                   # $1 = 'm'
                                   # $2 = 'ming republic of Perl'

     The first string position that this regexp can match is at
     the first 'm' in "programming". At this position, the
     minimal "m{1,2}?" matches just one 'm'.  Although the second
     quantifier ".*?" would prefer to match no characters, it is
     constrained by the end-of-string anchor "$" to match the
     rest of the string.

         $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                       # $1 = 'The progra'
                                       # $2 = 'm'
                                       # $3 = 'ming republic of Perl'

     In this regexp, you might expect the first minimal quantif-
     ier ".*?" to match the empty string, because it is not con-
     strained by a "^" anchor to match the beginning of the word.
     Principle 0 applies here, however.  Because it is possible
     for the whole regexp to match at the start of the string, it
     will match at the start of the string.  Thus the first quan-
     tifier has to match everything up to the first "m".  The
     second minimal quantifier matches just one "m" and the third
     quantifier matches the rest of the string.

         $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                      # $1 = 'a'
                                      # $2 = 'mm'
                                      # $3 = 'ing republic of Perl'

     Just as in the previous regexp, the first quantifier ".??"
     can match earliest at position 'a', so it does.  The second
     quantifier is greedy, so it matches "mm", and the third
     matches the rest of the string.

     We can modify principle 3 above to take into account non-
     greedy quantifiers:

     +   Principle 3: If there are two or more elements in a
         regexp, the leftmost greedy (non-greedy) quantifier, if
         any, will match as much (little) of the string as possi-
         ble while still allowing the whole regexp to match.  The
         next leftmost greedy (non-greedy) quantifier, if any,
         will try to match as much (little) of the string remain-
         ing available to it as possible, while still allowing
         the whole regexp to match.  And so on, until all the
         regexp elements are satisfied.

perl v5.8.8                2006-06-30                          20

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     Just like alternation, quantifiers are also susceptible to
     backtracking.  Here is a step-by-step analysis of the exam-
     ple

         $x = "the cat in the hat";
         $x =~ /^(.*)(at)(.*)$/; # matches,
                                 # $1 = 'the cat in the h'
                                 # $2 = 'at'
                                 # $3 = ''   (0 matches)

     0   Start with the first letter in the string 't'.

     1   The first quantifier '.*' starts out by matching the
         whole string 'the cat in the hat'.

     2   'a' in the regexp element 'at' doesn't match the end of
         the string.  Backtrack one character.

     3   'a' in the regexp element 'at' still doesn't match the
         last letter of the string 't', so backtrack one more
         character.

     4   Now we can match the 'a' and the 't'.

     5   Move on to the third element '.*'.  Since we are at the
         end of the string and '.*' can match 0 times, assign it
         the empty string.

     6   We are done!

     Most of the time, all this moving forward and backtracking
     happens quickly and searching is fast.   There are some
     pathological regexps, however, whose execution time exponen-
     tially grows with the size of the string.  A typical struc-
     ture that blows up in your face is of the form

         /(a|b+)*/;

     The problem is the nested indeterminate quantifiers.  There
     are many different ways of partitioning a string of length n
     between the "+" and "*": one repetition with "b+" of length
     n, two repetitions with the first "b+" length k and the
     second with length n-k, m repetitions whose bits add up to
     length n, etc.  In fact there are an exponential number of
     ways to partition a string as a function of length.  A
     regexp may get lucky and match early in the process, but if
     there is no match, perl will try every possibility before
     giving up.  So be careful with nested "*"'s, "{n,m}"'s, and
     "+"'s.  The book Mastering regular expressions by Jeffrey
     Friedl gives a wonderful discussion of this and other effi-
     ciency issues.

perl v5.8.8                2006-06-30                          21

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     Building a regexp

     At this point, we have all the basic regexp concepts
     covered, so let's give a more involved example of a regular
     expression.  We will build a regexp that matches numbers.

     The first task in building a regexp is to decide what we
     want to match and what we want to exclude.  In our case, we
     want to match both integers and floating point numbers and
     we want to reject any string that isn't a number.

     The next task is to break the problem down into smaller
     problems that are easily converted into a regexp.

     The simplest case is integers.  These consist of a sequence
     of digits, with an optional sign in front.  The digits we
     can represent with "\d+" and the sign can be matched with
     "[+-]".  Thus the integer regexp is

         /[+-]?\d+/;  # matches integers

     A floating point number potentially has a sign, an integral
     part, a decimal point, a fractional part, and an exponent.
     One or more of these parts is optional, so we need to check
     out the different possibilities.  Floating point numbers
     which are in proper form include 123., 0.345, .34, -1e6, and
     25.4E-72.  As with integers, the sign out front is com-
     pletely optional and can be matched by "[+-]?".  We can see
     that if there is no exponent, floating point numbers must
     have a decimal point, otherwise they are integers.  We might
     be tempted to model these with "\d*\.\d*", but this would
     also match just a single decimal point, which is not a
     number.  So the three cases of floating point number sans
     exponent are

        /[+-]?\d+\./;  # 1., 321., etc.
        /[+-]?\.\d+/;  # .1, .234, etc.
        /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

     These can be combined into a single regexp with a three-way
     alternation:

        /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

     In this alternation, it is important to put '\d+\.\d+'
     before '\d+\.'.  If '\d+\.' were first, the regexp would
     happily match that and ignore the fractional part of the
     number.

     Now consider floating point numbers with exponents.  The key
     observation here is that both integers and numbers with
     decimal points are allowed in front of an exponent.  Then

perl v5.8.8                2006-06-30                          22

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     exponents, like the overall sign, are independent of whether
     we are matching numbers with or without decimal points, and
     can be 'decoupled' from the mantissa.  The overall form of
     the regexp now becomes clear:

         /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

     The exponent is an "e" or "E", followed by an integer.  So
     the exponent regexp is

        /[eE][+-]?\d+/;  # exponent

     Putting all the parts together, we get a regexp that matches
     numbers:

        /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

     Long regexps like this may impress your friends, but can be
     hard to decipher.  In complex situations like this, the
     "//x" modifier for a match is invaluable.  It allows one to
     put nearly arbitrary whitespace and comments into a regexp
     without affecting their meaning.  Using it, we can rewrite
     our 'extended' regexp in the more pleasing form

        /^
           [+-]?         # first, match an optional sign
           (             # then match integers or f.p. mantissas:
               \d+\.\d+  # mantissa of the form a.b
              |\d+\.     # mantissa of the form a.
              |\.\d+     # mantissa of the form .b
              |\d+       # integer of the form a
           )
           ([eE][+-]?\d+)?  # finally, optionally match an exponent
        $/x;

     If whitespace is mostly irrelevant, how does one include
     space characters in an extended regexp? The answer is to
     backslash it '\ '  or put it in a character class "[ ]" .
     The same thing goes for pound signs, use "\#" or "[#]".  For
     instance, Perl allows a space between the sign and the
     mantissa/integer, and we could add this to our regexp as
     follows:

perl v5.8.8                2006-06-30                          23

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

        /^
           [+-]?\ *      # first, match an optional sign *and space*
           (             # then match integers or f.p. mantissas:
               \d+\.\d+  # mantissa of the form a.b
              |\d+\.     # mantissa of the form a.
              |\.\d+     # mantissa of the form .b
              |\d+       # integer of the form a
           )
           ([eE][+-]?\d+)?  # finally, optionally match an exponent
        $/x;

     In this form, it is easier to see a way to simplify the
     alternation.  Alternatives 1, 2, and 4 all start with "\d+",
     so it could be factored out:

        /^
           [+-]?\ *      # first, match an optional sign
           (             # then match integers or f.p. mantissas:
               \d+       # start out with a ...
               (
                   \.\d* # mantissa of the form a.b or a.
               )?        # ? takes care of integers of the form a
              |\.\d+     # mantissa of the form .b
           )
           ([eE][+-]?\d+)?  # finally, optionally match an exponent
        $/x;

     or written in the compact form,

         /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

     This is our final regexp.  To recap, we built a regexp by

     +   specifying the task in detail,

     +   breaking down the problem into smaller parts,

     +   translating the small parts into regexps,

     +   combining the regexps,

     +   and optimizing the final combined regexp.

     These are also the typical steps involved in writing a com-
     puter program.  This makes perfect sense, because regular
     expressions are essentially programs written a little com-
     puter language that specifies patterns.

     Using regular expressions in Perl

     The last topic of Part 1 briefly covers how regexps are used
     in Perl programs.  Where do they fit into Perl syntax?

perl v5.8.8                2006-06-30                          24

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     We have already introduced the matching operator in its
     default "/regexp/" and arbitrary delimiter "m!regexp!"
     forms.  We have used the binding operator "=~" and its nega-
     tion "!~" to test for string matches.  Associated with the
     matching operator, we have discussed the single line "//s",
     multi-line "//m", case-insensitive "//i" and extended "//x"
     modifiers.

     There are a few more things you might want to know about
     matching operators.  First, we pointed out earlier that
     variables in regexps are substituted before the regexp is
     evaluated:

         $pattern = 'Seuss';
         while (<>) {
             print if /$pattern/;
         }

     This will print any lines containing the word "Seuss".  It
     is not as efficient as it could be, however, because perl
     has to re-evaluate $pattern each time through the loop.  If
     $pattern won't be changing over the lifetime of the script,
     we can add the "//o" modifier, which directs perl to only
     perform variable substitutions once:

         #!/usr/bin/perl
         #    Improved simple_grep
         $regexp = shift;
         while (<>) {
             print if /$regexp/o;  # a good deal faster
         }

     If you change $pattern after the first substitution happens,
     perl will ignore it.  If you don't want any substitutions at
     all, use the special delimiter "m''":

         @pattern = ('Seuss');
         while (<>) {
             print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
         }

     "m''" acts like single quotes on a regexp; all other "m"
     delimiters act like double quotes.  If the regexp evaluates
     to the empty string, the regexp in the last successful match
     is used instead.  So we have

         "dog" =~ /d/;  # 'd' matches
         "dogbert =~ //;  # this matches the 'd' regexp used before

     The final two modifiers "//g" and "//c" concern multiple
     matches. The modifier "//g" stands for global matching and
     allows the matching operator to match within a string as

perl v5.8.8                2006-06-30                          25

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     many times as possible. In scalar context, successive invo-
     cations against a string will have `"//g" jump from match to
     match, keeping track of position in the string as it goes
     along.  You can get or set the position with the "pos()"
     function.

     The use of "//g" is shown in the following example.  Suppose
     we have a string that consists of words separated by spaces.
     If we know how many words there are in advance, we could
     extract the words using groupings:

         $x = "cat dog house"; # 3 words
         $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                # $1 = 'cat'
                                                # $2 = 'dog'
                                                # $3 = 'house'

     But what if we had an indeterminate number of words? This is
     the sort of task "//g" was made for.  To extract all words,
     form the simple regexp "(\w+)" and loop over all matches
     with "/(\w+)/g":

         while ($x =~ /(\w+)/g) {
             print "Word is $1, ends at position ", pos $x, "\n";
         }

     prints

         Word is cat, ends at position 3
         Word is dog, ends at position 7
         Word is house, ends at position 13

     A failed match or changing the target string resets the
     position.  If you don't want the position reset after
     failure to match, add the "//c", as in "/regexp/gc".  The
     current position in the string is associated with the
     string, not the regexp.  This means that different strings
     have different positions and their respective positions can
     be set or read independently.

     In list context, "//g" returns a list of matched groupings,
     or if there are no groupings, a list of matches to the whole
     regexp.  So if we wanted just the words, we could use

         @words = ($x =~ /(\w+)/g);  # matches,
                                     # $word[0] = 'cat'
                                     # $word[1] = 'dog'
                                     # $word[2] = 'house'

     Closely associated with the "//g" modifier is the "\G"
     anchor.  The "\G" anchor matches at the point where the pre-
     vious "//g" match left off.  "\G" allows us to easily do

perl v5.8.8                2006-06-30                          26

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     context-sensitive matching:

         $metric = 1;  # use metric units
         ...
         $x = <FILE>;  # read in measurement
         $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
         $weight = $1;
         if ($metric) { # error checking
             print "Units error!" unless $x =~ /\Gkg\./g;
         }
         else {
             print "Units error!" unless $x =~ /\Glbs\./g;
         }
         $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

     The combination of "//g" and "\G" allows us to process the
     string a bit at a time and use arbitrary Perl logic to
     decide what to do next. Currently, the "\G" anchor is only
     fully supported when used to anchor to the start of the pat-
     tern.

     "\G" is also invaluable in processing fixed length records
     with regexps.  Suppose we have a snippet of coding region
     DNA, encoded as base pair letters "ATCGTTGAAT..." and we
     want to find all the stop codons "TGA".  In a coding region,
     codons are 3-letter sequences, so we can think of the DNA
     snippet as a sequence of 3-letter records.  The naive regexp

         # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
         $dna = "ATCGTTGAATGCAAATGACATGAC";
         $dna =~ /TGA/;

     doesn't work; it may match a "TGA", but there is no guaran-
     tee that the match is aligned with codon boundaries, e.g.,
     the substring "GTT GAA"  gives a match.  A better solution
     is

         while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
             print "Got a TGA stop codon at position ", pos $dna, "\n";
         }

     which prints

         Got a TGA stop codon at position 18
         Got a TGA stop codon at position 23

     Position 18 is good, but position 23 is bogus.  What hap-
     pened?

     The answer is that our regexp works well until we get past
     the last real match.  Then the regexp will fail to match a
     synchronized "TGA" and start stepping ahead one character

perl v5.8.8                2006-06-30                          27

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     position at a time, not what we want.  The solution is to
     use "\G" to anchor the match to the codon alignment:

         while ($dna =~ /\G(\w\w\w)*?TGA/g) {
             print "Got a TGA stop codon at position ", pos $dna, "\n";
         }

     This prints

         Got a TGA stop codon at position 18

     which is the correct answer.  This example illustrates that
     it is important not only to match what is desired, but to
     reject what is not desired.

     search and replace

     Regular expressions also play a big role in search and
     replace operations in Perl.  Search and replace is accom-
     plished with the "s///" operator.  The general form is
     "s/regexp/replacement/modifiers", with everything we know
     about regexps and modifiers applying in this case as well.
     The "replacement" is a Perl double quoted string that
     replaces in the string whatever is matched with the
     "regexp".  The operator "=~" is also used here to associate
     a string with "s///".  If matching against $_, the "$_ =~"
     can be dropped.  If there is a match, "s///" returns the
     number of substitutions made, otherwise it returns false.
     Here are a few examples:

         $x = "Time to feed the cat!";
         $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
         if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
             $more_insistent = 1;
         }
         $y = "'quoted words'";
         $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                # $y contains "quoted words"

     In the last example, the whole string was matched, but only
     the part inside the single quotes was grouped.  With the
     "s///" operator, the matched variables $1, $2, etc.  are
     immediately available for use in the replacement expression,
     so we use $1 to replace the quoted string with just what was
     quoted.  With the global modifier, "s///g" will search and
     replace all occurrences of the regexp in the string:

perl v5.8.8                2006-06-30                          28

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         $x = "I batted 4 for 4";
         $x =~ s/4/four/;   # doesn't do it all:
                            # $x contains "I batted four for 4"
         $x = "I batted 4 for 4";
         $x =~ s/4/four/g;  # does it all:
                            # $x contains "I batted four for four"

     If you prefer 'regex' over 'regexp' in this tutorial, you
     could use the following program to replace it:

         % cat > simple_replace
         #!/usr/bin/perl
         $regexp = shift;
         $replacement = shift;
         while (<>) {
             s/$regexp/$replacement/go;
             print;
         }
         ^D

         % simple_replace regexp regex perlretut.pod

     In "simple_replace" we used the "s///g" modifier to replace
     all occurrences of the regexp on each line and the "s///o"
     modifier to compile the regexp only once.  As with
     "simple_grep", both the "print" and the
     "s/$regexp/$replacement/go" use $_ implicitly.

     A modifier available specifically to search and replace is
     the "s///e" evaluation modifier.  "s///e" wraps an
     "eval{...}" around the replacement string and the evaluated
     result is substituted for the matched substring.  "s///e" is
     useful if you need to do a bit of computation in the process
     of replacing text.  This example counts character frequen-
     cies in a line:

         $x = "Bill the cat";
         $x =~ s/(.)/$chars{$1}++;$1/eg;  # final $1 replaces char with itself
         print "frequency of '$_' is $chars{$_}\n"
             foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

     This prints

         frequency of ' ' is 2
         frequency of 't' is 2
         frequency of 'l' is 2
         frequency of 'B' is 1
         frequency of 'c' is 1
         frequency of 'e' is 1
         frequency of 'h' is 1
         frequency of 'i' is 1
         frequency of 'a' is 1

perl v5.8.8                2006-06-30                          29

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     As with the match "m//" operator, "s///" can use other del-
     imiters, such as "s!!!" and "s{}{}", and even "s{}//".  If
     single quotes are used "s'''", then the regexp and replace-
     ment are treated as single quoted strings and there are no
     substitutions.  "s///" in list context returns the same
     thing as in scalar context, i.e., the number of matches.

     The split operator

     The "split"  function can also optionally use a matching
     operator "m//" to split a string.  "split /regexp/, string,
     limit" splits "string" into a list of substrings and returns
     that list.  The regexp is used to match the character
     sequence that the "string" is split with respect to.  The
     "limit", if present, constrains splitting into no more than
     "limit" number of strings.  For example, to split a string
     into words, use

         $x = "Calvin and Hobbes";
         @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                    # $word[1] = 'and'
                                    # $word[2] = 'Hobbes'

     If the empty regexp "//" is used, the regexp always matches
     and the string is split into individual characters.  If the
     regexp has groupings, then list produced contains the
     matched substrings from the groupings as well.  For
     instance,

         $x = "/usr/bin/perl";
         @dirs = split m!/!, $x;  # $dirs[0] = ''
                                  # $dirs[1] = 'usr'
                                  # $dirs[2] = 'bin'
                                  # $dirs[3] = 'perl'
         @parts = split m!(/)!, $x;  # $parts[0] = ''
                                     # $parts[1] = '/'
                                     # $parts[2] = 'usr'
                                     # $parts[3] = '/'
                                     # $parts[4] = 'bin'
                                     # $parts[5] = '/'
                                     # $parts[6] = 'perl'

     Since the first character of $x matched the regexp, "split"
     prepended an empty initial element to the list.

     If you have read this far, congratulations! You now have all
     the basic tools needed to use regular expressions to solve a
     wide range of text processing problems.  If this is your
     first time through the tutorial, why not stop here and play
     around with regexps a while...  Part 2 concerns the more
     esoteric aspects of regular expressions and those concepts
     certainly aren't needed right at the start.

perl v5.8.8                2006-06-30                          30

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

Part 2: Power tools
     OK, you know the basics of regexps and you want to know
     more.  If matching regular expressions is analogous to a
     walk in the woods, then the tools discussed in Part 1 are
     analogous to topo maps and a compass, basic tools we use all
     the time.  Most of the tools in part 2 are analogous to
     flare guns and satellite phones.  They aren't used too often
     on a hike, but when we are stuck, they can be invaluable.

     What follows are the more advanced, less used, or sometimes
     esoteric capabilities of perl regexps.  In Part 2, we will
     assume you are comfortable with the basics and concentrate
     on the new features.

     More on characters, strings, and character classes

     There are a number of escape sequences and character classes
     that we haven't covered yet.

     There are several escape sequences that convert characters
     or strings between upper and lower case.  "\l" and "\u" con-
     vert the next character to lower or upper case, respec-
     tively:

         $x = "perl";
         $string =~ /\u$x/;  # matches 'Perl' in $string
         $x = "M(rs?|s)\\."; # note the double backslash
         $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

     "\L" and "\U" converts a whole substring, delimited by "\L"
     or "\U" and "\E", to lower or upper case:

         $x = "This word is in lower case:\L SHOUT\E";
         $x =~ /shout/;       # matches
         $x = "I STILL KEYPUNCH CARDS FOR MY 360"
         $x =~ /\Ukeypunch/;  # matches punch card string

     If there is no "\E", case is converted until the end of the
     string. The regexps "\L\u$word" or "\u\L$word" convert the
     first character of $word to uppercase and the rest of the
     characters to lowercase.

     Control characters can be escaped with "\c", so that a
     control-Z character would be matched with "\cZ".  The escape
     sequence "\Q"..."\E" quotes, or protects most non-alphabetic
     characters.   For instance,

         $x = "\QThat !^*&%~& cat!";
         $x =~ /\Q!^*&%~&\E/;  # check for rough language

     It does not protect "$" or "@", so that variables can still
     be substituted.

perl v5.8.8                2006-06-30                          31

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     With the advent of 5.6.0, perl regexps can handle more than
     just the standard ASCII character set.  Perl now supports
     Unicode, a standard for encoding the character sets from
     many of the world's written languages.  Unicode does this by
     allowing characters to be more than one byte wide.  Perl
     uses the UTF-8 encoding, in which ASCII characters are still
     encoded as one byte, but characters greater than "chr(127)"
     may be stored as two or more bytes.

     What does this mean for regexps? Well, regexp users don't
     need to know much about perl's internal representation of
     strings.  But they do need to know 1) how to represent
     Unicode characters in a regexp and 2) when a matching opera-
     tion will treat the string to be searched as a sequence of
     bytes (the old way) or as a sequence of Unicode characters
     (the new way).  The answer to 1) is that Unicode characters
     greater than "chr(127)" may be represented using the
     "\x{hex}" notation, with "hex" a hexadecimal integer:

         /\x{263a}/;  # match a Unicode smiley face :)

     Unicode characters in the range of 128-255 use two hexade-
     cimal digits with braces: "\x{ab}".  Note that this is dif-
     ferent than "\xab", which is just a hexadecimal byte with no
     Unicode significance.

     NOTE: in Perl 5.6.0 it used to be that one needed to say
     "use utf8" to use any Unicode features.  This is no more the
     case: for almost all Unicode processing, the explicit "utf8"
     pragma is not needed.  (The only case where it matters is if
     your Perl script is in Unicode and encoded in UTF-8, then an
     explicit "use utf8" is needed.)

     Figuring out the hexadecimal sequence of a Unicode character
     you want or deciphering someone else's hexadecimal Unicode
     regexp is about as much fun as programming in machine code.
     So another way to specify Unicode characters is to use the
     named character  escape sequence "\N{name}".  "name" is a
     name for the Unicode character, as specified in the Unicode
     standard.  For instance, if we wanted to represent or match
     the astrological sign for the planet Mercury, we could use

         use charnames ":full"; # use named chars with Unicode full names
         $x = "abc\N{MERCURY}def";
         $x =~ /\N{MERCURY}/;   # matches

     One can also use short names or restrict names to a certain
     alphabet:

         use charnames ':full';
         print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";

perl v5.8.8                2006-06-30                          32

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         use charnames ":short";
         print "\N{greek:Sigma} is an upper-case sigma.\n";

         use charnames qw(greek);
         print "\N{sigma} is Greek sigma\n";

     A list of full names is found in the file Names.txt in the
     lib/perl5/5.X.X/unicore directory.

     The answer to requirement 2), as of 5.6.0, is that if a
     regexp contains Unicode characters, the string is searched
     as a sequence of Unicode characters.  Otherwise, the string
     is searched as a sequence of bytes.  If the string is being
     searched as a sequence of Unicode characters, but matching a
     single byte is required, we can use the "\C" escape
     sequence.  "\C" is a character class akin to "." except that
     it matches any byte 0-255.  So

         use charnames ":full"; # use named chars with Unicode full names
         $x = "a";
         $x =~ /\C/;  # matches 'a', eats one byte
         $x = "";
         $x =~ /\C/;  # doesn't match, no bytes to match
         $x = "\N{MERCURY}";  # two-byte Unicode character
         $x =~ /\C/;  # matches, but dangerous!

     The last regexp matches, but is dangerous because the string
     character position is no longer synchronized to the string
     byte position.  This generates the warning 'Malformed UTF-8
     character'.  The "\C" is best used for matching the binary
     data in strings with binary data intermixed with Unicode
     characters.

     Let us now discuss the rest of the character classes.  Just
     as with Unicode characters, there are named Unicode charac-
     ter classes represented by the "\p{name}" escape sequence.
     Closely associated is the "\P{name}" character class, which
     is the negation of the "\p{name}" class.  For example, to
     match lower and uppercase characters,

         use charnames ":full"; # use named chars with Unicode full names
         $x = "BOB";
         $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
         $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
         $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
         $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

     Here is the association between some Perl named classes and
     the traditional Unicode classes:

         Perl class name  Unicode class name or regular expression

perl v5.8.8                2006-06-30                          33

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         IsAlpha          /^[LM]/
         IsAlnum          /^[LMN]/
         IsASCII          $code <= 127
         IsCntrl          /^C/
         IsBlank          $code =~ /^(0020|0009)$/ || /^Z[^lp]/
         IsDigit          Nd
         IsGraph          /^([LMNPS]|Co)/
         IsLower          Ll
         IsPrint          /^([LMNPS]|Co|Zs)/
         IsPunct          /^P/
         IsSpace          /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
         IsSpacePerl      /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
         IsUpper          /^L[ut]/
         IsWord           /^[LMN]/ || $code eq "005F"
         IsXDigit         $code =~ /^00(3[0-9]|[46][1-6])$/

     You can also use the official Unicode class names with the
     "\p" and "\P", like "\p{L}" for Unicode 'letters', or
     "\p{Lu}" for uppercase letters, or "\P{Nd}" for non-digits.
     If a "name" is just one letter, the braces can be dropped.
     For instance, "\pM" is the character class of Unicode
     'marks', for example accent marks. For the full list see
     perlunicode.

     The Unicode has also been separated into various sets of
     characters which you can test with "\p{In...}" (in) and
     "\P{In...}" (not in), for example "\p{Latin}", "\p{Greek}",
     or "\P{Katakana}". For the full list see perlunicode.

     "\X" is an abbreviation for a character class sequence that
     includes the Unicode 'combining character sequences'.  A
     'combining character sequence' is a base character followed
     by any number of combining characters.  An example of a com-
     bining character is an accent.   Using the Unicode full
     names, e.g., "A + COMBINING RING"  is a combining character
     sequence with base character "A" and combining character
     "COMBINING RING" , which translates in Danish to A with the
     circle atop it, as in the word Angstrom.  "\X" is equivalent
     to "\PM\pM*}", i.e., a non-mark followed by one or more
     marks.

     For the full and latest information about Unicode see the
     latest Unicode standard, or the Unicode Consortium's website
     http://www.unicode.org/

     As if all those classes weren't enough, Perl also defines
     POSIX style character classes.  These have the form
     "[:name:]", with "name" the name of the POSIX class.  The
     POSIX classes are "alpha", "alnum", "ascii", "cntrl",
     "digit", "graph", "lower", "print", "punct", "space",
     "upper", and "xdigit", and two extensions, "word" (a Perl
     extension to match "\w"), and "blank" (a GNU extension).  If

perl v5.8.8                2006-06-30                          34

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     "utf8" is being used, then these classes are defined the
     same as their corresponding perl Unicode classes:
     "[:upper:]" is the same as "\p{IsUpper}", etc.  The POSIX
     character classes, however, don't require using "utf8".  The
     "[:digit:]", "[:word:]", and "[:space:]" correspond to the
     familiar "\d", "\w", and "\s" character classes.  To negate
     a POSIX class, put a "^" in front of the name, so that,
     e.g., "[:^digit:]" corresponds to "\D" and under "utf8",
     "\P{IsDigit}".  The Unicode and POSIX character classes can
     be used just like "\d", with the exception that POSIX char-
     acter classes can only be used inside of a character class:

         /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
         /^=item\s[[:digit:]]/;      # match '=item',
                                     # followed by a space and a digit
         use charnames ":full";
         /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
         /^=item\s\p{IsDigit}/;        # match '=item',
                                       # followed by a space and a digit

     Whew! That is all the rest of the characters and character
     classes.

     Compiling and saving regular expressions

     In Part 1 we discussed the "//o" modifier, which compiles a
     regexp just once.  This suggests that a compiled regexp is
     some data structure that can be stored once and used again
     and again.  The regexp quote "qr//" does exactly that:
     "qr/string/" compiles the "string" as a regexp and
     transforms the result into a form that can be assigned to a
     variable:

         $reg = qr/foo+bar?/;  # reg contains a compiled regexp

     Then $reg can be used as a regexp:

         $x = "fooooba";
         $x =~ $reg;     # matches, just like /foo+bar?/
         $x =~ /$reg/;   # same thing, alternate form

     $reg can also be interpolated into a larger regexp:

         $x =~ /(abc)?$reg/;  # still matches

     As with the matching operator, the regexp quote can use dif-
     ferent delimiters, e.g., "qr!!", "qr{}" and "qr~~".  The
     single quote delimiters "qr''" prevent any interpolation
     from taking place.

     Pre-compiled regexps are useful for creating dynamic matches
     that don't need to be recompiled each time they are

perl v5.8.8                2006-06-30                          35

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     encountered.  Using pre-compiled regexps, "simple_grep" pro-
     gram can be expanded into a program that matches multiple
     patterns:

         % cat > multi_grep
         #!/usr/bin/perl
         # multi_grep - match any of <number> regexps
         # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

         $number = shift;
         $regexp[$_] = shift foreach (0..$number-1);
         @compiled = map qr/$_/, @regexp;
         while ($line = <>) {
             foreach $pattern (@compiled) {
                 if ($line =~ /$pattern/) {
                     print $line;
                     last;  # we matched, so move onto the next line
                 }
             }
         }
         ^D

         % multi_grep 2 last for multi_grep
             $regexp[$_] = shift foreach (0..$number-1);
                 foreach $pattern (@compiled) {
                         last;

     Storing pre-compiled regexps in an array @compiled allows us
     to simply loop through the regexps without any recompila-
     tion, thus gaining flexibility without sacrificing speed.

     Embedding comments and modifiers in a regular expression

     Starting with this section, we will be discussing Perl's set
     of extended patterns.  These are extensions to the tradi-
     tional regular expression syntax that provide powerful new
     tools for pattern matching.  We have already seen extensions
     in the form of the minimal matching constructs "??", "*?",
     "+?", "{n,m}?", and "{n,}?".  The rest of the extensions
     below have the form "(?char...)", where the "char" is a
     character that determines the type of extension.

     The first extension is an embedded comment "(?#text)".  This
     embeds a comment into the regular expression without affect-
     ing its meaning.  The comment should not have any closing
     parentheses in the text.  An example is

         /(?# Match an integer:)[+-]?\d+/;

     This style of commenting has been largely superseded by the
     raw, freeform commenting that is allowed with the "//x"
     modifier.

perl v5.8.8                2006-06-30                          36

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     The modifiers "//i", "//m", "//s", and "//x" can also embed-
     ded in a regexp using "(?i)", "(?m)", "(?s)", and "(?x)".
     For instance,

         /(?i)yes/;  # match 'yes' case insensitively
         /yes/i;     # same thing
         /(?x)(          # freeform version of an integer regexp
                  [+-]?  # match an optional sign
                  \d+    # match a sequence of digits
              )
         /x;

     Embedded modifiers can have two important advantages over
     the usual modifiers.  Embedded modifiers allow a custom set
     of modifiers to each regexp pattern.  This is great for
     matching an array of regexps that must have different modif-
     iers:

         $pattern[0] = '(?i)doctor';
         $pattern[1] = 'Johnson';
         ...
         while (<>) {
             foreach $patt (@pattern) {
                 print if /$patt/;
             }
         }

     The second advantage is that embedded modifiers only affect
     the regexp inside the group the embedded modifier is con-
     tained in.  So grouping can be used to localize the
     modifier's effects:

         /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

     Embedded modifiers can also turn off any modifiers already
     present by using, e.g., "(?-i)".  Modifiers can also be com-
     bined into a single expression, e.g., "(?s-i)" turns on sin-
     gle line mode and turns off case insensitivity.

     Non-capturing groupings

     We noted in Part 1 that groupings "()" had two distinct
     functions: 1) group regexp elements together as a single
     unit, and 2) extract, or capture, substrings that matched
     the regexp in the grouping.  Non-capturing groupings,
     denoted by "(?:regexp)", allow the regexp to be treated as a
     single unit, but don't extract substrings or set matching
     variables $1, etc.  Both capturing and non-capturing group-
     ings are allowed to co-exist in the same regexp.  Because
     there is no extraction, non-capturing groupings are faster
     than capturing groupings.  Non-capturing groupings are also
     handy for choosing exactly which parts of a regexp are to be

perl v5.8.8                2006-06-30                          37

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     extracted to matching variables:

         # match a number, $1-$4 are set, but we only want $1
         /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

         # match a number faster , only $1 is set
         /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

         # match a number, get $1 = whole number, $2 = exponent
         /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

     Non-capturing groupings are also useful for removing nui-
     sance elements gathered from a split operation:

         $x = '12a34b5';
         @num = split /(a|b)/, $x;    # @num = ('12','a','34','b','5')
         @num = split /(?:a|b)/, $x;  # @num = ('12','34','5')

     Non-capturing groupings may also have embedded modifiers:
     "(?i-m:regexp)" is a non-capturing grouping that matches
     "regexp" case insensitively and turns off multi-line mode.

     Looking ahead and looking behind

     This section concerns the lookahead and lookbehind asser-
     tions.  First, a little background.

     In Perl regular expressions, most regexp elements 'eat up' a
     certain amount of string when they match.  For instance, the
     regexp element "[abc}]" eats up one character of the string
     when it matches, in the sense that perl moves to the next
     character position in the string after the match.  There are
     some elements, however, that don't eat up characters
     (advance the character position) if they match.  The exam-
     ples we have seen so far are the anchors.  The anchor "^"
     matches the beginning of the line, but doesn't eat any char-
     acters.  Similarly, the word boundary anchor "\b" matches,
     e.g., if the character to the left is a word character and
     the character to the right is a non-word character, but it
     doesn't eat up any characters itself.  Anchors are examples
     of 'zero-width assertions'.  Zero-width, because they con-
     sume no characters, and assertions, because they test some
     property of the string.  In the context of our walk in the
     woods analogy to regexp matching, most regexp elements move
     us along a trail, but anchors have us stop a moment and
     check our surroundings.  If the local environment checks
     out, we can proceed forward.  But if the local environment
     doesn't satisfy us, we must backtrack.

     Checking the environment entails either looking ahead on the
     trail, looking behind, or both.  "^" looks behind, to see
     that there are no characters before.  "$" looks ahead, to

perl v5.8.8                2006-06-30                          38

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     see that there are no characters after.  "\b" looks both
     ahead and behind, to see if the characters on either side
     differ in their 'word'-ness.

     The lookahead and lookbehind assertions are generalizations
     of the anchor concept.  Lookahead and lookbehind are zero-
     width assertions that let us specify which characters we
     want to test for.  The lookahead assertion is denoted by
     "(?=regexp)" and the lookbehind assertion is denoted by
     "(?<=fixed-regexp)".  Some examples are

         $x = "I catch the housecat 'Tom-cat' with catnip";
         $x =~ /cat(?=\s+)/;  # matches 'cat' in 'housecat'
         @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                # $catwords[0] = 'catch'
                                                # $catwords[1] = 'catnip'
         $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
         $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                   # middle of $x

     Note that the parentheses in "(?=regexp)" and "(?<=regexp)"
     are non-capturing, since these are zero-width assertions.
     Thus in the second regexp, the substrings captured are those
     of the whole regexp itself.  Lookahead "(?=regexp)" can
     match arbitrary regexps, but lookbehind "(?<=fixed-regexp)"
     only works for regexps of fixed width, i.e., a fixed number
     of characters long.  Thus "(?<=(ab|bc))" is fine, but
     "(?<=(ab)*)" is not.  The negated versions of the lookahead
     and lookbehind assertions are denoted by "(?!regexp)" and
     "(?<!fixed-regexp)" respectively. They evaluate true if the
     regexps do not match:

         $x = "foobar";
         $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
         $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
         $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

     The "\C" is unsupported in lookbehind, because the already
     treacherous definition of "\C" would become even more so
     when going backwards.

     Using independent subexpressions to prevent backtracking

     The last few extended patterns in this tutorial are experi-
     mental as of 5.6.0.  Play with them, use them in some code,
     but don't rely on them just yet for production code.

     Independent subexpressions  are regular expressions, in the
     context of a larger regular expression, that function
     independently of the larger regular expression.  That is,
     they consume as much or as little of the string as they wish
     without regard for the ability of the larger regexp to

perl v5.8.8                2006-06-30                          39

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     match.  Independent subexpressions are represented by
     "(?>regexp)".  We can illustrate their behavior by first
     considering an ordinary regexp:

         $x = "ab";
         $x =~ /a*ab/;  # matches

     This obviously matches, but in the process of matching, the
     subexpression "a*" first grabbed the "a".  Doing so, how-
     ever, wouldn't allow the whole regexp to match, so after
     backtracking, "a*" eventually gave back the "a" and matched
     the empty string.  Here, what "a*" matched was dependent on
     what the rest of the regexp matched.

     Contrast that with an independent subexpression:

         $x =~ /(?>a*)ab/;  # doesn't match!

     The independent subexpression "(?>a*)" doesn't care about
     the rest of the regexp, so it sees an "a" and grabs it.
     Then the rest of the regexp "ab" cannot match.  Because
     "(?>a*)" is independent, there is no backtracking and the
     independent subexpression does not give up its "a".  Thus
     the match of the regexp as a whole fails.  A similar
     behavior occurs with completely independent regexps:

         $x = "ab";
         $x =~ /a*/g;   # matches, eats an 'a'
         $x =~ /\Gab/g; # doesn't match, no 'a' available

     Here "//g" and "\G" create a 'tag team' handoff of the
     string from one regexp to the other.  Regexps with an
     independent subexpression are much like this, with a handoff
     of the string to the independent subexpression, and a hand-
     off of the string back to the enclosing regexp.

     The ability of an independent subexpression to prevent back-
     tracking can be quite useful.  Suppose we want to match a
     non-empty string enclosed in parentheses up to two levels
     deep.  Then the following regexp matches:

         $x = "abc(de(fg)h";  # unbalanced parentheses
         $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;

     The regexp matches an open parenthesis, one or more copies
     of an alternation, and a close parenthesis.  The alternation
     is two-way, with the first alternative "[^()]+" matching a
     substring with no parentheses and the second alternative
     "\([^()]*\)"  matching a substring delimited by parentheses.
     The problem with this regexp is that it is pathological: it
     has nested indeterminate quantifiers of the form "(a+|b)+".
     We discussed in Part 1 how nested quantifiers like this

perl v5.8.8                2006-06-30                          40

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     could take an exponentially long time to execute if there
     was no match possible.  To prevent the exponential blowup,
     we need to prevent useless backtracking at some point.  This
     can be done by enclosing the inner quantifier as an indepen-
     dent subexpression:

         $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;

     Here, "(?>[^()]+)" breaks the degeneracy of string parti-
     tioning by gobbling up as much of the string as possible and
     keeping it.   Then match failures fail much more quickly.

     Conditional expressions

     A conditional expression  is a form of if-then-else state-
     ment that allows one to choose which patterns are to be
     matched, based on some condition.  There are two types of
     conditional expression: "(?(condition)yes-regexp)" and
     "(?(condition)yes-regexp|no-regexp)".
     "(?(condition)yes-regexp)" is like an 'if () {}'  statement
     in Perl.  If the "condition" is true, the "yes-regexp" will
     be matched.  If the "condition" is false, the "yes-regexp"
     will be skipped and perl will move onto the next regexp ele-
     ment.  The second form is like an 'if () {} else {}'  state-
     ment in Perl.  If the "condition" is true, the "yes-regexp"
     will be matched, otherwise the "no-regexp" will be matched.

     The "condition" can have two forms.  The first form is sim-
     ply an integer in parentheses "(integer)".  It is true if
     the corresponding backreference "\integer" matched earlier
     in the regexp.  The second form is a bare zero width asser-
     tion "(?...)", either a lookahead, a lookbehind, or a code
     assertion (discussed in the next section).

     The integer form of the "condition" allows us to choose,
     with more flexibility, what to match based on what matched
     earlier in the regexp. This searches for words of the form
     "$x$x" or "$x$y$y$x":

         % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
         beriberi
         coco
         couscous
         deed
         ...
         toot
         toto
         tutu

     The lookbehind "condition" allows, along with backrefer-
     ences, an earlier part of the match to influence a later
     part of the match.  For instance,

perl v5.8.8                2006-06-30                          41

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         /[ATGC]+(?(?<=AA)G|C)$/;

     matches a DNA sequence such that it either ends in "AAG", or
     some other base pair combination and "C".  Note that the
     form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for the
     lookahead, lookbehind or code assertions, the parentheses
     around the conditional are not needed.

     A bit of magic: executing Perl code in a regular expression

     Normally, regexps are a part of Perl expressions.
     Code evaluation  expressions turn that around by allowing
     arbitrary Perl code to be a part of a regexp.  A code
     evaluation expression is denoted "(?{code})", with "code" a
     string of Perl statements.

     Code expressions are zero-width assertions, and the value
     they return depends on their environment.  There are two
     possibilities: either the code expression is used as a con-
     ditional in a conditional expression "(?(condition)...)", or
     it is not.  If the code expression is a conditional, the
     code is evaluated and the result (i.e., the result of the
     last statement) is used to determine truth or falsehood.  If
     the code expression is not used as a conditional, the asser-
     tion always evaluates true and the result is put into the
     special variable $^R.  The variable $^R can then be used in
     code expressions later in the regexp.  Here are some silly
     examples:

         $x = "abcdef";
         $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                              # prints 'Hi Mom!'
         $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                              # no 'Hi Mom!'

     Pay careful attention to the next example:

         $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                              # no 'Hi Mom!'
                                              # but why not?

     At first glance, you'd think that it shouldn't print,
     because obviously the "ddd" isn't going to match the target
     string. But look at this example:

         $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
                                                # but _does_ print

     Hmm. What happened here? If you've been following along, you
     know that the above pattern should be effectively the same
     as the last one -- enclosing the d in a character class
     isn't going to change what it matches. So why does the first

perl v5.8.8                2006-06-30                          42

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     not print while the second one does?

     The answer lies in the optimizations the REx engine makes.
     In the first case, all the engine sees are plain old charac-
     ters (aside from the "?{}" construct). It's smart enough to
     realize that the string 'ddd' doesn't occur in our target
     string before actually running the pattern through. But in
     the second case, we've tricked it into thinking that our
     pattern is more complicated than it is. It takes a look,
     sees our character class, and decides that it will have to
     actually run the pattern to determine whether or not it
     matches, and in the process of running it hits the print
     statement before it discovers that we don't have a match.

     To take a closer look at how the engine does optimizations,
     see the section "Pragmas and debugging" below.

     More fun with "?{}":

         $x =~ /(?{print "Hi Mom!";})/;       # matches,
                                              # prints 'Hi Mom!'
         $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                # prints '1'
         $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                # prints '1'

     The bit of magic mentioned in the section title occurs when
     the regexp backtracks in the process of searching for a
     match.  If the regexp backtracks over a code expression and
     if the variables used within are localized using "local",
     the changes in the variables produced by the code expression
     are undone! Thus, if we wanted to count how many times a
     character got matched inside a group, we could use, e.g.,

         $x = "aaaa";
         $count = 0;  # initialize 'a' count
         $c = "bob";  # test if $c gets clobbered
         $x =~ /(?{local $c = 0;})         # initialize count
                ( a                        # match 'a'
                  (?{local $c = $c + 1;})  # increment count
                )*                         # do this any number of times,
                aa                         # but match 'aa' at the end
                (?{$count = $c;})          # copy local $c var into $count
               /x;
         print "'a' count is $count, \$c variable is '$c'\n";

     This prints

         'a' count is 2, $c variable is 'bob'

     If we replace the " (?{local $c = $c + 1;})"  with
     " (?{$c = $c + 1;})" , the variable changes are not undone

perl v5.8.8                2006-06-30                          43

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     during backtracking, and we get

         'a' count is 4, $c variable is 'bob'

     Note that only localized variable changes are undone.  Other
     side effects of code expression execution are permanent.
     Thus

         $x = "aaaa";
         $x =~ /(a(?{print "Yow\n";}))*aa/;

     produces

        Yow
        Yow
        Yow
        Yow

     The result $^R is automatically localized, so that it will
     behave properly in the presence of backtracking.

     This example uses a code expression in a conditional to
     match the article 'the' in either English or German:

         $lang = 'DE';  # use German
         ...
         $text = "das";
         print "matched\n"
             if $text =~ /(?(?{
                               $lang eq 'EN'; # is the language English?
                              })
                            the |             # if so, then match 'the'
                            (die|das|der)     # else, match 'die|das|der'
                          )
                         /xi;

     Note that the syntax here is
     "(?(?{...})yes-regexp|no-regexp)", not
     "(?((?{...}))yes-regexp|no-regexp)".  In other words, in the
     case of a code expression, we don't need the extra
     parentheses around the conditional.

     If you try to use code expressions with interpolating vari-
     ables, perl may surprise you:

         $bar = 5;
         $pat = '(?{ 1 })';
         /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
         /foo(?{ 1 })$bar/;   # compile error!
         /foo${pat}bar/;      # compile error!

perl v5.8.8                2006-06-30                          44

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
         /foo${pat}bar/;      # compiles ok

     If a regexp has (1) code expressions and interpolating vari-
     ables, or (2) a variable that interpolates a code expres-
     sion, perl treats the regexp as an error. If the code
     expression is precompiled into a variable, however, interpo-
     lating is ok. The question is, why is this an error?

     The reason is that variable interpolation and code expres-
     sions together pose a security risk.  The combination is
     dangerous because many programmers who write search engines
     often take user input and plug it directly into a regexp:

         $regexp = <>;       # read user-supplied regexp
         $chomp $regexp;     # get rid of possible newline
         $text =~ /$regexp/; # search $text for the $regexp

     If the $regexp variable contains a code expression, the user
     could then execute arbitrary Perl code.  For instance, some
     joker could search for "system('rm -rf *');"  to erase your
     files.  In this sense, the combination of interpolation and
     code expressions taints your regexp.  So by default, using
     both interpolation and code expressions in the same regexp
     is not allowed.  If you're not concerned about malicious
     users, it is possible to bypass this security check by
     invoking "use re 'eval'" :

         use re 'eval';       # throw caution out the door
         $bar = 5;
         $pat = '(?{ 1 })';
         /foo(?{ 1 })$bar/;   # compiles ok
         /foo${pat}bar/;      # compiles ok

     Another form of code expression is the
     pattern code expression . The pattern code expression is
     like a regular code expression, except that the result of
     the code evaluation is treated as a regular expression and
     matched immediately.  A simple example is

         $length = 5;
         $char = 'a';
         $x = 'aaaaabb';
         $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'

     This final example contains both ordinary and pattern code
     expressions.   It detects if a binary string
     1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,...  of
     the 1's:

perl v5.8.8                2006-06-30                          45

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         $s0 = 0; $s1 = 1; # initial conditions
         $x = "1101010010001000001";
         print "It is a Fibonacci sequence\n"
             if $x =~ /^1         # match an initial '1'
                         (
                            (??{'0' x $s0}) # match $s0 of '0'
                            1               # and then a '1'
                            (?{
                               $largest = $s0;   # largest seq so far
                               $s2 = $s1 + $s0;  # compute next term
                               $s0 = $s1;        # in Fibonacci sequence
                               $s1 = $s2;
                              })
                         )+   # repeat as needed
                       $      # that is all there is
                      /x;
         print "Largest sequence matched was $largest\n";

     This prints

         It is a Fibonacci sequence
         Largest sequence matched was 5

     Ha! Try that with your garden variety regexp package...

     Note that the variables $s0 and $s1 are not substituted when
     the regexp is compiled, as happens for ordinary variables
     outside a code expression.  Rather, the code expressions are
     evaluated when perl encounters them during the search for a
     match.

     The regexp without the "//x" modifier is

         /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;

     and is a great start on an Obfuscated Perl entry :-) When
     working with code and conditional expressions, the extended
     form of regexps is almost necessary in creating and debug-
     ging regexps.

     Pragmas and debugging

     Speaking of debugging, there are several pragmas available
     to control and debug regexps in Perl.  We have already
     encountered one pragma in the previous section,
     "use re 'eval';" , that allows variable interpolation and
     code expressions to coexist in a regexp.  The other pragmas
     are

         use re 'taint';
         $tainted = <>;
         @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

perl v5.8.8                2006-06-30                          46

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     The "taint" pragma causes any substrings from a match with a
     tainted variable to be tainted as well.  This is not nor-
     mally the case, as regexps are often used to extract the
     safe bits from a tainted variable.  Use "taint" when you are
     not extracting safe bits, but are performing some other pro-
     cessing.  Both "taint" and "eval" pragmas are lexically
     scoped, which means they are in effect only until the end of
     the block enclosing the pragmas.

         use re 'debug';
         /^(.*)$/s;       # output debugging info

         use re 'debugcolor';
         /^(.*)$/s;       # output debugging info in living color

     The global "debug" and "debugcolor" pragmas allow one to get
     detailed debugging info about regexp compilation and execu-
     tion.  "debugcolor" is the same as debug, except the debug-
     ging information is displayed in color on terminals that can
     display termcap color sequences.  Here is example output:

         % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
         Compiling REx `a*b+c'
         size 9 first at 1
            1: STAR(4)
            2:   EXACT <a>(0)
            4: PLUS(7)
            5:   EXACT <b>(0)
            7: EXACT <c>(9)
            9: END(0)
         floating `bc' at 0..2147483647 (checking floating) minlen 2
         Guessing start of match, REx `a*b+c' against `abc'...
         Found floating substr `bc' at offset 1...
         Guessed: match at offset 0
         Matching REx `a*b+c' against `abc'
           Setting an EVAL scope, savestack=3
            0 <> <abc>             |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            1 <a> <bc>             |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            2 <ab> <c>             |  7:      EXACT <c>
            3 <abc> <>             |  9:      END
         Match successful!
         Freeing REx: `a*b+c'

     If you have gotten this far into the tutorial, you can prob-
     ably guess what the different parts of the debugging output
     tell you.  The first part

perl v5.8.8                2006-06-30                          47

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         Compiling REx `a*b+c'
         size 9 first at 1
            1: STAR(4)
            2:   EXACT <a>(0)
            4: PLUS(7)
            5:   EXACT <b>(0)
            7: EXACT <c>(9)
            9: END(0)

     describes the compilation stage.  STAR(4) means that there
     is a starred object, in this case 'a', and if it matches,
     goto line 4, i.e., PLUS(7).  The middle lines describe some
     heuristics and optimizations performed before a match:

         floating `bc' at 0..2147483647 (checking floating) minlen 2
         Guessing start of match, REx `a*b+c' against `abc'...
         Found floating substr `bc' at offset 1...
         Guessed: match at offset 0

     Then the match is executed and the remaining lines describe
     the process:

         Matching REx `a*b+c' against `abc'
           Setting an EVAL scope, savestack=3
            0 <> <abc>             |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            1 <a> <bc>             |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            2 <ab> <c>             |  7:      EXACT <c>
            3 <abc> <>             |  9:      END
         Match successful!
         Freeing REx: `a*b+c'

     Each step is of the form "n <x> <y>" , with "<x>" the part
     of the string matched and "<y>" the part not yet matched.
     The "| 1: STAR"  says that perl is at line number 1 n the
     compilation list above.  See "Debugging regular expressions"
     in perldebguts for much more detail.

     An alternative method of debugging regexps is to embed
     "print" statements within the regexp.  This provides a
     blow-by-blow account of the backtracking in an alternation:

perl v5.8.8                2006-06-30                          48

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

         "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                          t(?{print "t1\n";})
                          h(?{print "h1\n";})
                          i(?{print "i1\n";})
                          s(?{print "s1\n";})
                              |
                          t(?{print "t2\n";})
                          h(?{print "h2\n";})
                          a(?{print "a2\n";})
                          t(?{print "t2\n";})
                          (?{print "Done at position ", pos, "\n";})
                         @x;

     prints

         Start at position 0
         t1
         h1
         t2
         h2
         a2
         t2
         Done at position 4

BUGS

     Code expressions, conditional expressions, and independent
     expressions are experimental.  Don't use them in production
     code.  Yet.

SEE ALSO

     This is just a tutorial.  For the full story on perl regular
     expressions, see the perlre regular expressions reference
     page.

     For more information on the matching "m//" and substitution
     "s///" operators, see "Regexp Quote-Like Operators" in per-
     lop.  For information on the "split" operation, see "split"
     in perlfunc.

     For an excellent all-around resource on the care and feeding
     of regular expressions, see the book Mastering Regular
     Expressions by Jeffrey Friedl (published by O'Reilly, ISBN
     1556592-257-3).

AUTHOR AND COPYRIGHT

     Copyright (c) 2000 Mark Kvale All rights reserved.

     This document may be distributed under the same terms as
     Perl itself.

perl v5.8.8                2006-06-30                          49

PERLRETUT(1)    Perl Programmers Reference Guide     PERLRETUT(1)

     Acknowledgments

     The inspiration for the stop codon DNA example came from the
     ZIP code example in chapter 7 of Mastering Regular Expres-
     sions.

     The author would like to thank Jeff Pinyan, Andrew Johnson,
     Peter Haworth, Ronald J Kimball, and Joe Smith for all their
     helpful comments.

perl v5.8.8                2006-06-30                          50

Generated on 2013-04-27 00:20:00 by $MirOS: src/scripts/roff2htm,v 1.77 2013/01/01 20:49:09 tg Exp $

These manual pages and other documentation are copyrighted by their respective writers; their source is available at our CVSweb, AnonCVS, and other mirrors. The rest is Copyright © 2002‒2013 The MirOS Project, Germany.
This product includes material provided by Thorsten Glaser.

This manual page’s HTML representation is supposed to be valid XHTML/1.1; if not, please send a bug report – diffs preferred.